placecare😽 ​
placecare is a tool for predicting cis-regulatory elements based on string search algorithms using the PLACE database.
With placecare, you can:
Upload sequence files to search for cis-regulatory elements.
Quickly retrieve related information through PLACE database IDs and ACs (Data from the place.seq file provided by the official PLACE website)
Installation ​
If you have the Rust toolchain installed on your computer, you can install our command-line program using the following command:
cargo install placecareIf you haven't installed the Rust toolchain, you can also download our pre-compiled binary files directly from GitHub Release:
TIP
We have pre-compiled programs for Windows and Linux amd64 versions. If you want to use placecare on other platforms, the best approach is to install it through the Rust toolchain.
If you want to use our library, you just need:
cargo add placecareUsage ​
Using the Command-line Program ​
After installing the placecare command-line program, you can use it as follows:
- Search for Cis-regulatory Elements
The command-line program currently supports file input -i FILE_PATH and direct input -s TEXT.
There are also two output methods: print output -p and file output -w -o FILE_PATH. You can use both output methods simultaneously.
placecare search -i ./a.fasta -p
placecare search -s ATCATCATTATATATAACGGGGCCC -p
placecare search -i ./a.fasta -w -o output.txt
placecare search -s ATCATCATTATATATAACGGGGCCC -w -o output.txt- Query the PLACE Database by ID and AC
When querying, you need to choose which method to query by: using ID -q and using AC -a.
IMPORTANT
When using file input, each line should contain one ID or AC
placecare query -i ./id.txt -q -p
placecare query -i ./ac.txt -a -p
placecare query -s TATABOX1 -q -p
placecare query -s ./id.txt -q -w -o output.txtUsing Our Library ​
This section explains how to use our library. The core functionality of placehere is written in the place_search module, I/O operations are written in the io module, and the place_desc module contains descriptions of the PLACE data.
Searching for Elements ​
We provide multiple ways to input sequences, as shown below:
use placecare::io::RecordDesc;
let input = vec![RecordDesc::new("Gh_01", "TTATAGACTCGATGGCCGCGCGG")];
let input = RecordDesc::from_file("./input.fasta");
let input = RecordDesc::from_string("\
>Gh_01
ATATCCGGATGGCATGCTGATC
");
let input = RecordDesc::from_records(bio::io::fasta::Reader::new("./input.fasta"));
let mut f = File::open("input.txt").unwrap();
let input = RecordDesc::from_reader(f);Then we can perform the search:
use placecare::place_search::Search;
// Search for a single element
let result = Search::search_element(input).unwrap();
// Search for multiple elements
let result = Search::search_elements(input).unwrap();You can check the definitions in the place_desc module to understand the output information.
Querying Element Information ​
We can use the following methods to query information about elements in the PLACE database.
use placecare::search::Search;
// The function will return a vector of Option<SeqDesc>
// for which is a result of the input sequence.
let e1: Vec<Option<SeqDesc>> = query_elements_by_id(&vec!["TATABOX1", "TATABOX2"]);
let e2: Vec<Option<SeqDesc>> = query_elements_by_ac(&vec!["S000023", "S000260"]);Tips ​
IUPAC Ambiguous Bases ​
The PLACE database uses IUPAC ambiguous base symbols (Wikipedia) to represent multiple possible bases.
Citation ​
If your article uses this software, it means you used the libraries used by this software, please cite the following articles:
Higo, K., Ugawa, Y., Iwamoto, M. and Korenaga, T. "Plant cis-acting regulatory DNA elements (PLACE) database: 1999" Nucleic Acids Research, Volume 27, Issue 1, 1999, Pages 297-300.
Köster, J. (2016). Rust-Bio: a fast and safe bioinformatics library. Bioinformatics, 32(3), 444-446.